hCG_1731871-hCG1731871 Gene View larger

hCG_1731871-hCG1731871 Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of hCG_1731871-hCG1731871 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about hCG_1731871-hCG1731871 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025725
Product type: DNA & cDNA
Ncbi symbol: hCG_1731871
Origin species: Human
Product name: hCG_1731871-hCG1731871 Gene
Size: 2ug
Accessions: BC025725
Gene id: 653687
Gene description: hCG1731871
Synonyms: CXorf50B; LINC00246B; NCRNA00246B; family with sequence similarity 226, member B (non-protein coding)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaagtatgtcatcaaaaggtacaggagcttcctccctgagattttcaagaaagcctctgacctccccgagttagtctttgggttctatctgaaggaacttgatccagcagagcactcctatgtcttgatcagaaaaatcgatcctgccctggtttggggcctgacaggcgaccagggcacaccaaagacccggctcctgatgattactctggactcgatcttcatgcaggccagctgtgtccccgaggaggtggtctgggaggtgttgagggtgttggaggcacatttcgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - calpain 3, (p94)
- sorting nexin 12
- lysozyme G-like 1
- MARCKS-like 1

Buy hCG_1731871-hCG1731871 Gene now

Add to cart