Login to display prices
Login to display prices
hCG_1731871-hCG1731871 Gene View larger

hCG_1731871-hCG1731871 Gene

PTXBC025725

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of hCG_1731871-hCG1731871 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about hCG_1731871-hCG1731871 Gene

Proteogenix catalog: PTXBC025725
Ncbi symbol: hCG_1731871
Product name: hCG_1731871-hCG1731871 Gene
Size: 2ug
Accessions: BC025725
Gene id: 653687
Gene description: hCG1731871
Synonyms: CXorf50B; LINC00246B; NCRNA00246B; family with sequence similarity 226, member B (non-protein coding)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgaagtatgtcatcaaaaggtacaggagcttcctccctgagattttcaagaaagcctctgacctccccgagttagtctttgggttctatctgaaggaacttgatccagcagagcactcctatgtcttgatcagaaaaatcgatcctgccctggtttggggcctgacaggcgaccagggcacaccaaagacccggctcctgatgattactctggactcgatcttcatgcaggccagctgtgtccccgaggaggtggtctgggaggtgttgagggtgttggaggcacatttcgtctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: