No products
Prices are tax excluded
PTXBC009192
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009192 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LSM2 |
| Origin species: | Human |
| Product name: | LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC009192 |
| Gene id: | 57819 |
| Gene description: | LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) |
| Synonyms: | LSM2 homolog, U6 small nuclear RNA and mRNA degradation associated; LSM2 homolog, U6 small nuclear RNA associated; LSM2 U6 small nuclear RNA and mRNA degradation associated; U6 snRNA-associated Sm-like protein LSm2; C6orf28; G7B; YBL026W; snRNP; protein G7b; small nuclear ribonuclear protein D homolog; snRNP core Sm-like protein Sm-x5 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcttctattcttttttcaagtcccttgtgggcaaggatgtggtcgtggaactaaagaatgacctgagcatctgtggaaccctccattctgtggatcagtatctcaacatcaaactaactgacatcagtgtcacagaccctgagaaataccctcacatgttatcagtgaagaactgcttcattcggggctcagtggtccgatacgtgcagctgccagcagatgaggtcgacacacagttgctacaggatgcggcaaggaaggaagccctgcagcagaaacagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa - myosin, light chain 6B, alkali, smooth muscle and non-muscle - phosphatidic acid phosphatase type 2 domain containing 1B - eukaryotic translation initiation factor 4E family member 2 |