LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene View larger

LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009192
Product type: DNA & cDNA
Ncbi symbol: LSM2
Origin species: Human
Product name: LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene
Size: 2ug
Accessions: BC009192
Gene id: 57819
Gene description: LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae)
Synonyms: LSM2 homolog, U6 small nuclear RNA and mRNA degradation associated; LSM2 homolog, U6 small nuclear RNA associated; LSM2 U6 small nuclear RNA and mRNA degradation associated; U6 snRNA-associated Sm-like protein LSm2; C6orf28; G7B; YBL026W; snRNP; protein G7b; small nuclear ribonuclear protein D homolog; snRNP core Sm-like protein Sm-x5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctcttctattcttttttcaagtcccttgtgggcaaggatgtggtcgtggaactaaagaatgacctgagcatctgtggaaccctccattctgtggatcagtatctcaacatcaaactaactgacatcagtgtcacagaccctgagaaataccctcacatgttatcagtgaagaactgcttcattcggggctcagtggtccgatacgtgcagctgccagcagatgaggtcgacacacagttgctacaggatgcggcaaggaaggaagccctgcagcagaaacagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa
- myosin, light chain 6B, alkali, smooth muscle and non-muscle
- phosphatidic acid phosphatase type 2 domain containing 1B
- eukaryotic translation initiation factor 4E family member 2

Buy LSM2-LSM2 homolog, U6 small nuclear RNA associated (S. cerevisiae) Gene now

Add to cart