MGC13057-hypothetical protein MGC13057 Gene View larger

MGC13057-hypothetical protein MGC13057 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC13057-hypothetical protein MGC13057 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MGC13057-hypothetical protein MGC13057 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005083
Product type: DNA & cDNA
Ncbi symbol: MGC13057
Origin species: Human
Product name: MGC13057-hypothetical protein MGC13057 Gene
Size: 2ug
Accessions: BC005083
Gene id: 84281
Gene description: hypothetical protein MGC13057
Synonyms: smAKAP; small membrane A-kinase anchor protein; small A-kinase anchoring protein; small membrane AKAP; chromosome 2 open reading frame 88
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgcatgaaatcaaagcaaactttcccatttcctaccatatatgaaggtgagaagcagcatgagagtgaagaaccctttatgccagaagagagatgtctacctaggatggcttctccagttaatgtcaaagaggaagtgaaggaacctccagggaccaatattgtgatcttggaatatgcacaccgcctgtctcaggatatcttgtgtgatgccttgcagcaatgggcatgcaataacatcaagtaccatgacattccatacattgagagtgaggggccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - S100 calcium binding protein A7
- chemokine (C-X-C motif) ligand 2
- SIVA1, apoptosis-inducing factor
- chemokine (C-X-C motif) ligand 5

Buy MGC13057-hypothetical protein MGC13057 Gene now

Add to cart