Login to display prices
Login to display prices
MGC13057-hypothetical protein MGC13057 Gene View larger

MGC13057-hypothetical protein MGC13057 Gene

PTXBC005083

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MGC13057-hypothetical protein MGC13057 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MGC13057-hypothetical protein MGC13057 Gene

Proteogenix catalog: PTXBC005083
Ncbi symbol: MGC13057
Product name: MGC13057-hypothetical protein MGC13057 Gene
Size: 2ug
Accessions: BC005083
Gene id: 84281
Gene description: hypothetical protein MGC13057
Synonyms: smAKAP; small membrane A-kinase anchor protein; small A-kinase anchoring protein; small membrane AKAP; chromosome 2 open reading frame 88
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctgcatgaaatcaaagcaaactttcccatttcctaccatatatgaaggtgagaagcagcatgagagtgaagaaccctttatgccagaagagagatgtctacctaggatggcttctccagttaatgtcaaagaggaagtgaaggaacctccagggaccaatattgtgatcttggaatatgcacaccgcctgtctcaggatatcttgtgtgatgccttgcagcaatgggcatgcaataacatcaagtaccatgacattccatacattgagagtgaggggccttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: