S100A8-S100 calcium binding protein A8 Gene View larger

S100A8-S100 calcium binding protein A8 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A8-S100 calcium binding protein A8 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about S100A8-S100 calcium binding protein A8 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005928
Product type: DNA & cDNA
Ncbi symbol: S100A8
Origin species: Human
Product name: S100A8-S100 calcium binding protein A8 Gene
Size: 2ug
Accessions: BC005928
Gene id: 6279
Gene description: S100 calcium binding protein A8
Synonyms: 60B8AG; CAGA; CFAG; CGLA; CP-10; L1Ag; MA387; MIF; MRP8; NIF; protein S100-A8; calgranulin A; calprotectin L1L subunit; cystic fibrosis antigen; leukocyte L1 complex light chain; migration inhibitory factor-related protein 8; urinary stone protein band A; S100 calcium binding protein A8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgaccgagctggagaaagccttgaactctatcatcgacgtctaccacaagtactccctgataaaggggaatttccatgccgtctacagggatgacctgaagaaattgctagagaccgagtgtcctcagtatatcaggaaaaagggtgcagacgtctggttcaaagagttggatatcaacactgatggtgcagttaacttccaggagttcctcattctggtgataaagatgggcgtggcagcccacaaaaaaagccatgaagaaagccacaaagagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical protein MGC13057
- S100 calcium binding protein A7
- chemokine (C-X-C motif) ligand 2
- SIVA1, apoptosis-inducing factor

Buy S100A8-S100 calcium binding protein A8 Gene now

Add to cart