Login to display prices
Login to display prices
S100A8-S100 calcium binding protein A8 Gene View larger

S100A8-S100 calcium binding protein A8 Gene

PTXBC005928

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of S100A8-S100 calcium binding protein A8 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about S100A8-S100 calcium binding protein A8 Gene

Proteogenix catalog: PTXBC005928
Ncbi symbol: S100A8
Product name: S100A8-S100 calcium binding protein A8 Gene
Size: 2ug
Accessions: BC005928
Gene id: 6279
Gene description: S100 calcium binding protein A8
Synonyms: 60B8AG; CAGA; CFAG; CGLA; CP-10; L1Ag; MA387; MIF; MRP8; NIF; protein S100-A8; calgranulin A; calprotectin L1L subunit; cystic fibrosis antigen; leukocyte L1 complex light chain; migration inhibitory factor-related protein 8; urinary stone protein band A; S100 calcium binding protein A8
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttgaccgagctggagaaagccttgaactctatcatcgacgtctaccacaagtactccctgataaaggggaatttccatgccgtctacagggatgacctgaagaaattgctagagaccgagtgtcctcagtatatcaggaaaaagggtgcagacgtctggttcaaagagttggatatcaacactgatggtgcagttaacttccaggagttcctcattctggtgataaagatgggcgtggcagcccacaaaaaaagccatgaagaaagccacaaagagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: