LRRC28-leucine rich repeat containing 28 Gene View larger

LRRC28-leucine rich repeat containing 28 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of LRRC28-leucine rich repeat containing 28 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about LRRC28-leucine rich repeat containing 28 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019704
Product type: DNA & cDNA
Ncbi symbol: LRRC28
Origin species: Human
Product name: LRRC28-leucine rich repeat containing 28 Gene
Size: 2ug
Accessions: BC019704
Gene id: 123355
Gene description: leucine rich repeat containing 28
Synonyms: leucine-rich repeat-containing protein 28; leucine rich repeat containing 28
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcgtccgaactttgtaagacgatctctgtggcaaggctagaaaagcacaagaatttgttcttaaattataggaatctgcaccattttccattggagttactgaaagatgagggactgcagtacttggagagactctatatgaaaaggaactccctgacatccttgccagaaaaccttgctcagaagcttccaaaccttgtggaactgaagacaactgttagttttgtggcttactgctgctccacccagtgtctgcagacttttgacctgctgagttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chemokine (C-X-C motif) ligand 11
- S100 calcium binding protein A14
- thioredoxin domain containing 17
- hypothetical protein LOC339047

Buy LRRC28-leucine rich repeat containing 28 Gene now

Add to cart