MANBAL-mannosidase, beta A, lysosomal-like Gene View larger

MANBAL-mannosidase, beta A, lysosomal-like Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MANBAL-mannosidase, beta A, lysosomal-like Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MANBAL-mannosidase, beta A, lysosomal-like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014672
Product type: DNA & cDNA
Ncbi symbol: MANBAL
Origin species: Human
Product name: MANBAL-mannosidase, beta A, lysosomal-like Gene
Size: 2ug
Accessions: BC014672
Gene id: 63905
Gene description: mannosidase, beta A, lysosomal-like
Synonyms: protein MANBAL; mannosidase beta A like; mannosidase, beta A, lysosomal-like; mannosidase beta like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctctgacctagacttctcacctccggaggtgcccgagcccactttcctggagaacctgctacggtacggactcttcctgggagccatcttccagctcatctgtgtgctggccatcatcgtacccattcccaagtcccacgaggcggaggctgaaccgtctgagcccagaagtgctgaggtgacgaggaagcccaaggctgctgttccttctgtgaacaagaggcccaagaaagagactaagaagaagcggtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 4 open reading frame 42
- chromosome 2 open reading frame 56
- chromosome 4 open reading frame 34
- chromosome 8 open reading frame 56

Buy MANBAL-mannosidase, beta A, lysosomal-like Gene now

Add to cart