Login to display prices
Login to display prices
C4orf34-chromosome 4 open reading frame 34 Gene View larger

C4orf34-chromosome 4 open reading frame 34 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C4orf34-chromosome 4 open reading frame 34 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C4orf34-chromosome 4 open reading frame 34 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008502
Product type: DNA & cDNA
Ncbi symbol: C4orf34
Origin species: Human
Product name: C4orf34-chromosome 4 open reading frame 34 Gene
Size: 2ug
Accessions: BC008502
Gene id: 201895
Gene description: chromosome 4 open reading frame 34
Synonyms: C4orf34; small integral membrane protein 14
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaaggtggatttgatccctgtgaatgtgtttgctctcatgaacatgcaatgagaagactgatcaatctgttacggcagtcccagtcctactgcacagacacagagtgtcttcaggaattaccgggaccctctggtgataatggcatcagtgttacaatgatcttggtagcctggatggttattgcattgatcttgttcttactgagacctcctaatctaagaggatccagcctacctggaaagccaaccagtcctcataatggacaagatccaccagctcctcctgtggactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 8 open reading frame 56
- protocadherin gamma subfamily C, 3
- chromosome 6 open reading frame 35
- mitochondrial ribosomal protein L42