Login to display prices
Login to display prices
C8orf56-chromosome 8 open reading frame 56 Gene View larger

C8orf56-chromosome 8 open reading frame 56 Gene

PTXBC029562

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C8orf56-chromosome 8 open reading frame 56 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C8orf56-chromosome 8 open reading frame 56 Gene

Proteogenix catalog: PTXBC029562
Ncbi symbol: C8orf56
Product name: C8orf56-chromosome 8 open reading frame 56 Gene
Size: 2ug
Accessions: BC029562
Gene id: 157556
Gene description: chromosome 8 open reading frame 56
Synonyms: chromosome 8 open reading frame 56
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccttaaagtcctggcatcctcagagcaagacaaaaagagtgggggcaagcgaaggtaacccccagtggggctctggaagtatggaggcccctctcctttcctccttccttccacctctggccagcgaggcagaactcacaggcaacacctggtttctgcacagatgcagctgcattttgaacctagaggaaagcatggacagcgactggggggcttggtggggggtgtcgctccctagaagggcaccttttctgatatatgggtcagatgggccttggtgcacacaggcaggcttcccaggatggggacattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: