Login to display prices
Login to display prices
C9orf62-chromosome 9 open reading frame 62 Gene View larger

C9orf62-chromosome 9 open reading frame 62 Gene

PTXBC034752

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf62-chromosome 9 open reading frame 62 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf62-chromosome 9 open reading frame 62 Gene

Proteogenix catalog: PTXBC034752
Ncbi symbol: C9orf62
Product name: C9orf62-chromosome 9 open reading frame 62 Gene
Size: 2ug
Accessions: BC034752
Gene id: 157927
Gene description: chromosome 9 open reading frame 62
Synonyms: chromosome 9 open reading frame 62
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcctcagcccagggcagacctcagtgtccttcctgtggccgctgctggaggtgcgtgaccacaacacagggaggggactcgtccccgccactgtgctgacgcctgggtctccagagaccctcctggaactccgccaggccttcctgggttccagacaggcccgccacgggcatgacgcagcgccatctagcggacagcagggctgcagcgtggacagaacggccggacgcccagtcctgggctggcggctgaggaacagcctcacagggcaagagggcaggcaacacctgcatctttccggcataagaacctcaagaaaagcaaaggaatataagcctgtgttctttggagccaccgaaatctctgttctcatggcagtcgctgaaagtttaagggagccgccaccgccccaatggggttggtttctttcttccctgtttttaaagatcttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice