Login to display prices
Login to display prices
C9orf62-chromosome 9 open reading frame 62 Gene View larger

C9orf62-chromosome 9 open reading frame 62 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C9orf62-chromosome 9 open reading frame 62 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C9orf62-chromosome 9 open reading frame 62 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034752
Product type: DNA & cDNA
Ncbi symbol: C9orf62
Origin species: Human
Product name: C9orf62-chromosome 9 open reading frame 62 Gene
Size: 2ug
Accessions: BC034752
Gene id: 157927
Gene description: chromosome 9 open reading frame 62
Synonyms: chromosome 9 open reading frame 62
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcctcagcccagggcagacctcagtgtccttcctgtggccgctgctggaggtgcgtgaccacaacacagggaggggactcgtccccgccactgtgctgacgcctgggtctccagagaccctcctggaactccgccaggccttcctgggttccagacaggcccgccacgggcatgacgcagcgccatctagcggacagcagggctgcagcgtggacagaacggccggacgcccagtcctgggctggcggctgaggaacagcctcacagggcaagagggcaggcaacacctgcatctttccggcataagaacctcaagaaaagcaaaggaatataagcctgtgttctttggagccaccgaaatctctgttctcatggcagtcgctgaaagtttaagggagccgccaccgccccaatggggttggtttctttcttccctgtttttaaagatcttttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SCAN domain containing 2 pseudogene
- chromosome 3 open reading frame 34
- destrin (actin depolymerizing factor)
- chromosome 9 open reading frame 71