SCAND2-SCAN domain containing 2 pseudogene Gene View larger

SCAND2-SCAN domain containing 2 pseudogene Gene

PTXBC011547

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCAND2-SCAN domain containing 2 pseudogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SCAND2-SCAN domain containing 2 pseudogene Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011547
Product type: DNA & cDNA
Ncbi symbol: SCAND2
Origin species: Human
Product name: SCAND2-SCAN domain containing 2 pseudogene Gene
Size: 2ug
Accessions: BC011547
Gene id: 54581
Gene description: SCAN domain containing 2 pseudogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtagctgtggaccaacaaatccagactccttcagtacaagatctccaaatagttaaactggaagaagattcccactgggagcaggaaatttcccttcaagggaattaccctggaccagagacatcctgccagagcttttggcatttccgttaccaagaagcatcacgaccccgagaggccctcctccagctccagaagctctgttgtcagtggctaaggccagagaagtgtacaaaagagcagatcctggagttgctggtcctagaacagttcccgactgtccttctccaggagatccagatctgggtcagacagcagcatccggagagtggagaggaggcagtggccctggtggaagacttgcagaaagaacctggaagacagaggctggagccctgcctgatgtggctctgggaattcctgcagagaagagcaggggtggccaggagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 3 open reading frame 34
- destrin (actin depolymerizing factor)
- chromosome 9 open reading frame 71
- R-spondin 2 homolog (Xenopus laevis)

Buy SCAND2-SCAN domain containing 2 pseudogene Gene now

Add to cart