DSTN-destrin (actin depolymerizing factor) Gene View larger

DSTN-destrin (actin depolymerizing factor) Gene

PTXBC009477

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DSTN-destrin (actin depolymerizing factor) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DSTN-destrin (actin depolymerizing factor) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009477
Product type: DNA & cDNA
Ncbi symbol: DSTN
Origin species: Human
Product name: DSTN-destrin (actin depolymerizing factor) Gene
Size: 2ug
Accessions: BC009477
Gene id: 11034
Gene description: destrin (actin depolymerizing factor)
Synonyms: ACTDP; ADF; HEL32; bA462D18.2; destrin; actin-depolymerizing factor; bA462D18.2 (destrin (actin depolymerizing factor ADF) (ACTDP)); epididymis luminal protein 32; destrin, actin depolymerizing factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctcaggagtgcaagtagctgatgaagtatgtcgcattttttatgacatgaaagttcgtaaatgctccacaccagaagaaatcaagaaaagaaagaaggctgtcattttttgtctcagtgcagacaaaaagtgcatcattgtagaagaaggcaaagagatcttggttggagatgttggtgtaaccataactgatcctttcaagcattttgtgggaatgcttcctgaaaaagattgtcgctatgctttgtatgatgcaagctttgaaacaaaagaatccagaaaagaagagttgatgttttttttgtgggcaccagaactagcacctctgaaaagtaaaatgatctatgcaagctccaaggatgcaattaaaaagaaatttcaaggcataaaacatgaatgtcaagcaaatggaccagaagatctcaatcgggcttgtattgctgaaaagttaggtggatccttaattgtagcctttgaaggatgccctgtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 9 open reading frame 71
- R-spondin 2 homolog (Xenopus laevis)
- chromosome 9 open reading frame 61
- mal, T-cell differentiation protein 2

Buy DSTN-destrin (actin depolymerizing factor) Gene now

Add to cart