C3orf34-chromosome 3 open reading frame 34 Gene View larger

C3orf34-chromosome 3 open reading frame 34 Gene

PTXBC007827

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C3orf34-chromosome 3 open reading frame 34 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C3orf34-chromosome 3 open reading frame 34 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007827
Product type: DNA & cDNA
Ncbi symbol: C3orf34
Origin species: Human
Product name: C3orf34-chromosome 3 open reading frame 34 Gene
Size: 2ug
Accessions: BC007827
Gene id: 84984
Gene description: chromosome 3 open reading frame 34
Synonyms: C3orf34; MOSPGF; centrosomal protein of 19 kDa; centrosomal protein 19kDa; centrosomal protein 19
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatgtgcactgccaagaaatgtgggattaggtttcagcctccagctattatcttaatctatgagagtgaaatcaaggggaaaattcgccagcgcattatgccagttcgaaacttttcaaagttttcagattgcaccagagctgctgaacaattaaagaataatccgcgacacaagagttacctagaacaagtatccctgaggcagctagagaagctattcagttttttacgaggttacttgtcggggcagagtctggcagaaacaatggaacaaattcaacgggaaacaaccattgatcctgaggaagacctgaacaaactagatgacaaggagcttgccaaaagaaagagcatcatggatgaactttttgagaaaaatcagaagaagaaggatgatccaaattttgtttatgacattgaggttgaatttccacaggacgatcaactgcagtcctgtggctgggacacagagtcagctgatgagttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - destrin (actin depolymerizing factor)
- chromosome 9 open reading frame 71
- R-spondin 2 homolog (Xenopus laevis)
- chromosome 9 open reading frame 61

Buy C3orf34-chromosome 3 open reading frame 34 Gene now

Add to cart