C4orf42-chromosome 4 open reading frame 42 Gene View larger

C4orf42-chromosome 4 open reading frame 42 Gene

PTXBC013775

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C4orf42-chromosome 4 open reading frame 42 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C4orf42-chromosome 4 open reading frame 42 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013775
Product type: DNA & cDNA
Ncbi symbol: C4orf42
Origin species: Human
Product name: C4orf42-chromosome 4 open reading frame 42 Gene
Size: 2ug
Accessions: BC013775
Gene id: 92070
Gene description: chromosome 4 open reading frame 42
Synonyms: C4orf42; CTBP1-AS1; CTBP1 antisense RNA 2 (head to head)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccaccgccctccagggtcagcgtttggctgtttgtgtgcctgcccacccgcctccctgtgcctgggcctgccctgtgcctgcacacaggaggggctcatggcgtttgccctacacggatgggctgtcctgggagctactggacagtcaccttggtgggaatgccagaggcatgggcattaggtccccccggccagcctccgttgccacatgggctatttttgtccatcgcgtgggacaacctagtattgggggaaaactcagtccactctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 2 open reading frame 56
- chromosome 4 open reading frame 34
- chromosome 8 open reading frame 56
- protocadherin gamma subfamily C, 3

Buy C4orf42-chromosome 4 open reading frame 42 Gene now

Add to cart