C2orf56-chromosome 2 open reading frame 56 Gene View larger

C2orf56-chromosome 2 open reading frame 56 Gene

PTXBC012374

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C2orf56-chromosome 2 open reading frame 56 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C2orf56-chromosome 2 open reading frame 56 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012374
Product type: DNA & cDNA
Ncbi symbol: C2orf56
Origin species: Human
Product name: C2orf56-chromosome 2 open reading frame 56 Gene
Size: 2ug
Accessions: BC012374
Gene id: 55471
Gene description: chromosome 2 open reading frame 56
Synonyms: C2orf56; MidA; PRO1853; protein arginine methyltransferase NDUFAF7, mitochondrial; NADH dehydrogenase (ubiquinone) complex I, assembly factor 7; NADH dehydrogenase [ubiquinone] complex I, assembly factor 7; mitochondrial dysfunction protein A homolog; protein midA homolog; protein midA homolog, mitochondrial; NADH:ubiquinone oxidoreductase complex assembly factor 7
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcacagggaaaagtagcctctctgggcccaataaaacaacacacatttttaaaaaatatgggtattgatgtccggctgaaggttcttttagataaatcaaatgagccatcagtgaggcagcagttacttcaaggatatgatatgttaatgaatccaaagaagatgggagagagatttaacttttttgccttgctacctcatcagagacttcaaggtggaagatatcagaggaatgcacgtcagtcaaaaccctttgcatccgttgtagctgggtttagtgaacttgcttggcagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 4 open reading frame 34
- chromosome 8 open reading frame 56
- protocadherin gamma subfamily C, 3
- chromosome 6 open reading frame 35

Buy C2orf56-chromosome 2 open reading frame 56 Gene now

Add to cart