PTXBC014300
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014300 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CTNNBIP1 |
| Origin species: | Human |
| Product name: | CTNNBIP1-catenin, beta interacting protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC014300 |
| Gene id: | 56998 |
| Gene description: | catenin, beta interacting protein 1 |
| Synonyms: | beta-catenin-interacting protein 1; beta-catenin-interacting protein ICAT; inhibitor of beta-catenin and Tcf-4; catenin beta interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaccgcgagggagctcccgggaagagtccggaggagatgtacattcagcagaaggtccgagtgctgctcatgctgcggaagatgggatcaaacctgacagccagcgaggaggagttcctgcgcacctatgcaggggtggtcaacagccagctcagccagctgcctccgcactccatcgaccagggtgcagaggacgtggtgatggcgttttccaggtcggagacggaagaccggaggcagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 15 open reading frame 48 - chromosome 16 open reading frame 57 - chromosome 16 open reading frame 52 - chromosome 18 open reading frame 20 |