CTNNBIP1-catenin, beta interacting protein 1 Gene View larger

CTNNBIP1-catenin, beta interacting protein 1 Gene

PTXBC014300

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CTNNBIP1-catenin, beta interacting protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CTNNBIP1-catenin, beta interacting protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC014300
Product type: DNA & cDNA
Ncbi symbol: CTNNBIP1
Origin species: Human
Product name: CTNNBIP1-catenin, beta interacting protein 1 Gene
Size: 2ug
Accessions: BC014300
Gene id: 56998
Gene description: catenin, beta interacting protein 1
Synonyms: beta-catenin-interacting protein 1; beta-catenin-interacting protein ICAT; inhibitor of beta-catenin and Tcf-4; catenin beta interacting protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaccgcgagggagctcccgggaagagtccggaggagatgtacattcagcagaaggtccgagtgctgctcatgctgcggaagatgggatcaaacctgacagccagcgaggaggagttcctgcgcacctatgcaggggtggtcaacagccagctcagccagctgcctccgcactccatcgaccagggtgcagaggacgtggtgatggcgttttccaggtcggagacggaagaccggaggcagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 15 open reading frame 48
- chromosome 16 open reading frame 57
- chromosome 16 open reading frame 52
- chromosome 18 open reading frame 20

Buy CTNNBIP1-catenin, beta interacting protein 1 Gene now

Add to cart