Login to display prices
Login to display prices
C16orf57-chromosome 16 open reading frame 57 Gene View larger

C16orf57-chromosome 16 open reading frame 57 Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf57-chromosome 16 open reading frame 57 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf57-chromosome 16 open reading frame 57 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010099
Product type: DNA & cDNA
Ncbi symbol: C16orf57
Origin species: Human
Product name: C16orf57-chromosome 16 open reading frame 57 Gene
Size: 2ug
Accessions: BC010099
Gene id: 79650
Gene description: chromosome 16 open reading frame 57
Synonyms: UPF0406 protein C16orf57; C16orf57; HVSL1; Mpn1; hUsb1; U6 snRNA phosphodiesterase; HVSL motif containing 1; U six biogenesis 1; U6 snRNA biogenesis 1; mutated in poikiloderma with neutropenia protein 1; U6 snRNA biogenesis phosphodiesterase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgcggcgcccctggtgggctacagcagcagcggctccgaggatgagtccgaggacgggatgcggaccaggccgggggatgggagccaccgtcgtggccagagcccccttcccaggcagagatttccagtacctgacagtgtgctgaacatgttcccgggcaccgaggaggggcctgaagatgacagcacaaaacacgggggacgggtgcgcaccttcccccacgagcgaggcaactgggccacccacgtctatgtaccatgtgagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 16 open reading frame 52
- chromosome 18 open reading frame 20
- chromosome 11 open reading frame 41
- chromosome 13 open reading frame 36