Login to display prices
Login to display prices
C18orf20-chromosome 18 open reading frame 20 Gene View larger

C18orf20-chromosome 18 open reading frame 20 Gene

PTXBC029565

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C18orf20-chromosome 18 open reading frame 20 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C18orf20-chromosome 18 open reading frame 20 Gene

Proteogenix catalog: PTXBC029565
Ncbi symbol: C18orf20
Product name: C18orf20-chromosome 18 open reading frame 20 Gene
Size: 2ug
Accessions: BC029565
Gene id: 221241
Gene description: chromosome 18 open reading frame 20
Synonyms: C18orf20; HsT1235; NCRNA00305; long intergenic non-protein coding RNA 305
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgatcaaccttcatagactgtgcattatacatgccatctctgcgacctgcaaagatgaaaagggaaagcaggagatggaaactggtcagcagccttctggtttatcagccacacttacaaaggtcaaatgtgcaaagcgtcagaagacagtggttagagtgagattctacatgctctcaatgaagaataaagcatgcaggaagaacctttcaaaaggttacaaccagagacctgaaggaagcaaggaagaaagccacatggttgtcaaagagaagaggaaaggagatcactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: