Login to display prices
Login to display prices
C19orf25-chromosome 19 open reading frame 25 Gene View larger

C19orf25-chromosome 19 open reading frame 25 Gene

PTXBC018441

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf25-chromosome 19 open reading frame 25 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf25-chromosome 19 open reading frame 25 Gene

Proteogenix catalog: PTXBC018441
Ncbi symbol: C19orf25
Product name: C19orf25-chromosome 19 open reading frame 25 Gene
Size: 2ug
Accessions: BC018441
Gene id: 148223
Gene description: chromosome 19 open reading frame 25
Synonyms: UPF0449 protein C19orf25; chromosome 19 open reading frame 25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctccaaggcaaagaagcgcgtgctgctgcccacccgcccagcgccccccacggtggagcagatcctggaggatgtgcggggtgcgccggcagaggatccagtgttcaccatcctggccccggaagaccccccagttcccttcaggatgatggaggatgcggaggccccgggagagcagctctaccagcaaagccgggcctacgtggctgccaaccagcggctgcagcaggcgggcaacgtgctgaggcagaggtgtgagctcctgcagcgagccggcgaggacctggagcgggaggtggcccagatgaagcaggcagcattaccggcagccgaggctgcctcctcaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: