C19orf25-chromosome 19 open reading frame 25 Gene View larger

C19orf25-chromosome 19 open reading frame 25 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf25-chromosome 19 open reading frame 25 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf25-chromosome 19 open reading frame 25 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018441
Product type: DNA & cDNA
Ncbi symbol: C19orf25
Origin species: Human
Product name: C19orf25-chromosome 19 open reading frame 25 Gene
Size: 2ug
Accessions: BC018441
Gene id: 148223
Gene description: chromosome 19 open reading frame 25
Synonyms: UPF0449 protein C19orf25; chromosome 19 open reading frame 25
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggctccaaggcaaagaagcgcgtgctgctgcccacccgcccagcgccccccacggtggagcagatcctggaggatgtgcggggtgcgccggcagaggatccagtgttcaccatcctggccccggaagaccccccagttcccttcaggatgatggaggatgcggaggccccgggagagcagctctaccagcaaagccgggcctacgtggctgccaaccagcggctgcagcaggcgggcaacgtgctgaggcagaggtgtgagctcctgcagcgagccggcgaggacctggagcgggaggtggcccagatgaagcaggcagcattaccggcagccgaggctgcctcctcaggctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - interferon, alpha-inducible protein 27
- chromosome 20 open reading frame 30
- chromosome 20 open reading frame 30
- chromosome 11 open reading frame 51

Buy C19orf25-chromosome 19 open reading frame 25 Gene now

Add to cart