Login to display prices
Login to display prices
C11orf51-chromosome 11 open reading frame 51 Gene View larger

C11orf51-chromosome 11 open reading frame 51 Gene

PTXBC005393

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf51-chromosome 11 open reading frame 51 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf51-chromosome 11 open reading frame 51 Gene

Proteogenix catalog: PTXBC005393
Ncbi symbol: C11orf51
Product name: C11orf51-chromosome 11 open reading frame 51 Gene
Size: 2ug
Accessions: BC005393
Gene id: 25906
Gene description: chromosome 11 open reading frame 51
Synonyms: C11orf51; APC15; HSPC020; anaphase-promoting complex subunit 15; anaphase promoting complex subunit 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccactttgttcccctcactcttccctcgtgtgactgagactctgtggtttaatctggatcgaccctgtgtggaagagacagagctgcagcagcaggaacagcagcatcaggcctggctccaaagcatcgcggagaaagacaacaacctggttcctattggcaagccagcttcagagcactatgatgacgaggaagaagaggatgatgaagatgatgaggatagtgaagaggactcagaggatgatgaggatatgcaggacatggacgagatgaatgactacaatgagtcaccggatgatggagaggtcaatgaggtggacatggaaggcaacgaacaggatcaggaccagtggatgatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: