C11orf51-chromosome 11 open reading frame 51 Gene View larger

C11orf51-chromosome 11 open reading frame 51 Gene

PTXBC005393

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C11orf51-chromosome 11 open reading frame 51 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C11orf51-chromosome 11 open reading frame 51 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC005393
Product type: DNA & cDNA
Ncbi symbol: C11orf51
Origin species: Human
Product name: C11orf51-chromosome 11 open reading frame 51 Gene
Size: 2ug
Accessions: BC005393
Gene id: 25906
Gene description: chromosome 11 open reading frame 51
Synonyms: C11orf51; APC15; HSPC020; anaphase-promoting complex subunit 15; anaphase promoting complex subunit 15
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccactttgttcccctcactcttccctcgtgtgactgagactctgtggtttaatctggatcgaccctgtgtggaagagacagagctgcagcagcaggaacagcagcatcaggcctggctccaaagcatcgcggagaaagacaacaacctggttcctattggcaagccagcttcagagcactatgatgacgaggaagaagaggatgatgaagatgatgaggatagtgaagaggactcagaggatgatgaggatatgcaggacatggacgagatgaatgactacaatgagtcaccggatgatggagaggtcaatgaggtggacatggaaggcaacgaacaggatcaggaccagtggatgatctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - rhomboid, veinlet-like 2 (Drosophila)
- chromosome 6 open reading frame 168
- family with sequence similarity 120C
- chromosome 14 open reading frame 48

Buy C11orf51-chromosome 11 open reading frame 51 Gene now

Add to cart