Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RHBDL2-rhomboid, veinlet-like 2 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RHBDL2-rhomboid, veinlet-like 2 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013103 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RHBDL2 |
| Origin species: | Human |
| Product name: | RHBDL2-rhomboid, veinlet-like 2 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC013103 |
| Gene id: | 54933 |
| Gene description: | rhomboid, veinlet-like 2 (Drosophila) |
| Synonyms: | RRP2; rhomboid-related protein 2; rhomboid (veinlet, Drosophila)-like 2; rhomboid protease 2; rhomboid, veinlet-like 2; rhomboid-like protein 2; rhomboid like 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatctgaatatggggagagagatgaaagaagagctggaggaagaggagaaaatgagagaggatgggggaggtaaagatcgggccaagagtaaaaaggtccacaggattgtctcaaaatggatgctgcccgaaaagtcccgaggaacatacttggagagagctaactgcttcccgcctcccgtgttcatcatctccatcagcctggccgagctggcagtgtttatttactatgctgtgtggaagcctcagaaacagtggatcacgttggacacaggcatcttggagagtccctttatctacagtcctgagaagagggaggaagcctggaggtttatctcatacatgctggtacatgctgggtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 6 open reading frame 168 - family with sequence similarity 120C - chromosome 14 open reading frame 48 - chromosome 11 open reading frame 45 |