Login to display prices
Login to display prices
RHBDL2-rhomboid, veinlet-like 2 (Drosophila) Gene View larger

RHBDL2-rhomboid, veinlet-like 2 (Drosophila) Gene

PTXBC013103

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RHBDL2-rhomboid, veinlet-like 2 (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RHBDL2-rhomboid, veinlet-like 2 (Drosophila) Gene

Proteogenix catalog: PTXBC013103
Ncbi symbol: RHBDL2
Product name: RHBDL2-rhomboid, veinlet-like 2 (Drosophila) Gene
Size: 2ug
Accessions: BC013103
Gene id: 54933
Gene description: rhomboid, veinlet-like 2 (Drosophila)
Synonyms: RRP2; rhomboid-related protein 2; rhomboid (veinlet, Drosophila)-like 2; rhomboid protease 2; rhomboid, veinlet-like 2; rhomboid-like protein 2; rhomboid like 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatctgaatatggggagagagatgaaagaagagctggaggaagaggagaaaatgagagaggatgggggaggtaaagatcgggccaagagtaaaaaggtccacaggattgtctcaaaatggatgctgcccgaaaagtcccgaggaacatacttggagagagctaactgcttcccgcctcccgtgttcatcatctccatcagcctggccgagctggcagtgtttatttactatgctgtgtggaagcctcagaaacagtggatcacgttggacacaggcatcttggagagtccctttatctacagtcctgagaagagggaggaagcctggaggtttatctcatacatgctggtacatgctgggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: