C12orf23-chromosome 12 open reading frame 23 Gene View larger

C12orf23-chromosome 12 open reading frame 23 Gene

PTXBC020522

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf23-chromosome 12 open reading frame 23 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf23-chromosome 12 open reading frame 23 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC020522
Product type: DNA & cDNA
Ncbi symbol: C12orf23
Origin species: Human
Product name: C12orf23-chromosome 12 open reading frame 23 Gene
Size: 2ug
Accessions: BC020522
Gene id: 90488
Gene description: chromosome 12 open reading frame 23
Synonyms: UPF0444 transmembrane protein C12orf23; C12orf23; transmembrane protein 263
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatcagacagataaaaatcaacaagaaatcccatcataccttaatgatgaaccaccagaaggttcaatgaaagatcacccacagcagcagccaggcatgttgtcccgtgtgactgggggtatcttcagtgttacaaagggagctgttggtgccaccattggtggtgtggcttggattggtggaaagagtctggaagtgaccaaaacagctgttacaactgtgccttccatgggaatagggctggtgaaagggggtgtctctgctgtggctggaggtgttacagctgttgggtctgctgttgtaaacaaagtgcccttaacaggaaagaagaaagacaaatctgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 19 open reading frame 25
- interferon, alpha-inducible protein 27
- chromosome 20 open reading frame 30
- chromosome 20 open reading frame 30

Buy C12orf23-chromosome 12 open reading frame 23 Gene now

Add to cart