Login to display prices
Login to display prices
C13orf36-chromosome 13 open reading frame 36 Gene View larger

C13orf36-chromosome 13 open reading frame 36 Gene

PTXBC036540

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C13orf36-chromosome 13 open reading frame 36 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C13orf36-chromosome 13 open reading frame 36 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC036540
Product type: DNA & cDNA
Ncbi symbol: C13orf36
Origin species: Human
Product name: C13orf36-chromosome 13 open reading frame 36 Gene
Size: 2ug
Accessions: BC036540
Gene id: 400120
Gene description: chromosome 13 open reading frame 36
Synonyms: C13orf36; serine-rich and transmembrane domain-containing protein 1; serine rich and transmembrane domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgaacctgacacttcctcaggattttcgggaagtgtggagaatggaacttttcttgagctgtttcccacatccctgtccacgtcagtggacccatcctcaggccacctgtcaaacgtctacatctatgtgtccatattcctcagccttttagcgtttctgcttctgcttttaatcattgccctccagaggctcaaaaatatcatctcctccagttcctcctacccagggtatccaagcgacgctggaagttctttcaccaatttggaagtctgcagcatttcctctcagaggtccactttttcaaacctttcatcctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 23
- chromosome 19 open reading frame 25
- interferon, alpha-inducible protein 27
- chromosome 20 open reading frame 30