PTXBC036540
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix | 
| Product type | DNA & cDNA | 
| Origin species | Human | 
| Brand: | ProteoGenix | 
| Proteogenix catalog: | PTXBC036540 | 
| Product type: | DNA & cDNA | 
| Ncbi symbol: | C13orf36 | 
| Origin species: | Human | 
| Product name: | C13orf36-chromosome 13 open reading frame 36 Gene | 
| Size: | 2ug | 
| Accessions: | BC036540 | 
| Gene id: | 400120 | 
| Gene description: | chromosome 13 open reading frame 36 | 
| Synonyms: | C13orf36; serine-rich and transmembrane domain-containing protein 1; serine rich and transmembrane domain containing 1 | 
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG | 
| Orf sequence: | atgtctgaacctgacacttcctcaggattttcgggaagtgtggagaatggaacttttcttgagctgtttcccacatccctgtccacgtcagtggacccatcctcaggccacctgtcaaacgtctacatctatgtgtccatattcctcagccttttagcgtttctgcttctgcttttaatcattgccctccagaggctcaaaaatatcatctcctccagttcctcctacccagggtatccaagcgacgctggaagttctttcaccaatttggaagtctgcagcatttcctctcagaggtccactttttcaaacctttcatcctga | 
| Vector: | pDONR223 | 
| Delivery lead time in business days in europe: | 10-12 days | 
| Storage: | -20â | 
| Delivery condition: | Blue Ice | 
| Related products: | - chromosome 12 open reading frame 23 - chromosome 19 open reading frame 25 - interferon, alpha-inducible protein 27 - chromosome 20 open reading frame 30  |