C16orf52-chromosome 16 open reading frame 52 Gene View larger

C16orf52-chromosome 16 open reading frame 52 Gene

PTXBC027604

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C16orf52-chromosome 16 open reading frame 52 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C16orf52-chromosome 16 open reading frame 52 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027604
Product type: DNA & cDNA
Ncbi symbol: C16orf52
Origin species: Human
Product name: C16orf52-chromosome 16 open reading frame 52 Gene
Size: 2ug
Accessions: BC027604
Gene id: 730094
Gene description: chromosome 16 open reading frame 52
Synonyms: uncharacterized protein C16orf52; chromosome 16 open reading frame 52
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggttacttctgccagattaatctgggaagaaacagagcactcactgtgggcctcgtgcgacagtgtcaaacaatccatggacgagaccggacgtgcatccctccccggcttcccccggagtgggtcaccacactgttttttatcatcatgggaatcatttcattgactgtcacatgtggtttgctggtggcttcccactggcgaagagaagctacaaaatatgctcgatggatagcattcactggaaagtgtgtgcattcttctcatacctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 18 open reading frame 20
- chromosome 11 open reading frame 41
- chromosome 13 open reading frame 36
- chromosome 12 open reading frame 23

Buy C16orf52-chromosome 16 open reading frame 52 Gene now

Add to cart