Login to display prices
Login to display prices
C15orf48-chromosome 15 open reading frame 48 Gene View larger

C15orf48-chromosome 15 open reading frame 48 Gene

PTXBC021173

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C15orf48-chromosome 15 open reading frame 48 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C15orf48-chromosome 15 open reading frame 48 Gene

Proteogenix catalog: PTXBC021173
Ncbi symbol: C15orf48
Product name: C15orf48-chromosome 15 open reading frame 48 Gene
Size: 2ug
Accessions: BC021173
Gene id: 84419
Gene description: chromosome 15 open reading frame 48
Synonyms: FOAP-11; NMES1; normal mucosa of esophagus-specific gene 1 protein; normal mucosa of esophagus specific 1; chromosome 15 open reading frame 48
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctttttccaactcctgatgaaaaggaaggaactcattcccttggtggtgttcatgactgtggcggcgggtggagcctcatctttcgctgtgtattctctttggaaaaccgatgtgatccttgatcgaaaaaaaaatccagaaccttgggaaactgtggaccctactgtacctcaaaagcttataacaatcaaccaacaatggaaacccattgaagagttgcaaaatgtccaaagggtgaccaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: