Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CDC42SE1-CDC42 small effector 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CDC42SE1-CDC42 small effector 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012796 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CDC42SE1 |
| Origin species: | Human |
| Product name: | CDC42SE1-CDC42 small effector 1 Gene |
| Size: | 2ug |
| Accessions: | BC012796 |
| Gene id: | 56882 |
| Gene description: | CDC42 small effector 1 |
| Synonyms: | SCIP1; SPEC1; CDC42 small effector protein 1; 1300002M12Rik; CDC42-binding protein SCIP1; signaling molecule SPEC1 beta; small effector of CDC42 protein 1; small protein effector 1 of Cdc42; CDC42 small effector 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagtgaattttggcacaaactgggctgctgtgtggtagagaaaccccagccgaagaagaagagaagacggattgaccggaccatgattggggaaccaatgaattttgttcacctgactcacattggctcaggggagatgggggccggagatggacttgccatgacaggtgcagttcaggagcagatgagatccaagggaaaccgagataggccatggagcaattctaggggcttatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - E2F transcription factor 2 - histone cluster 2, H4b - histone cluster 1, H4j - SPANX family, member B2 |