E2F2-E2F transcription factor 2 Gene View larger

E2F2-E2F transcription factor 2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of E2F2-E2F transcription factor 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about E2F2-E2F transcription factor 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007609
Product type: DNA & cDNA
Ncbi symbol: E2F2
Origin species: Human
Product name: E2F2-E2F transcription factor 2 Gene
Size: 2ug
Accessions: BC007609
Gene id: 1870
Gene description: E2F transcription factor 2
Synonyms: transcription factor E2F2; E2F-2; E2F transcription factor 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtctcgctctgttgcccaggctggagtgcagtggcctgatctcggctcactgcaacctctgcctcccaggttcaagcgattcttctgcctcagcctccagagtagctgggactatagacatgcaccaccacgcccggctaattttgtatttttggtcgagacggggttttgccatgttagtcaggctggtcttgaactcctgacctcaagtgatccaccacctcggcctcccaaagtgttgagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histone cluster 2, H4b
- histone cluster 1, H4j
- SPANX family, member B2
- histone cluster 3, H2a

Buy E2F2-E2F transcription factor 2 Gene now

Add to cart