Login to display prices
Login to display prices
HIST1H4J-histone cluster 1, H4j Gene View larger

HIST1H4J-histone cluster 1, H4j Gene

PTXBC017361

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST1H4J-histone cluster 1, H4j Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST1H4J-histone cluster 1, H4j Gene

Proteogenix catalog: PTXBC017361
Ncbi symbol: HIST1H4J
Product name: HIST1H4J-histone cluster 1, H4j Gene
Size: 2ug
Accessions: BC017361
Gene id: 8363
Gene description: histone cluster 1, H4j
Synonyms: H4/e; H4F2iv; H4FE; dJ160A22.2; histone H4; H4 histone family, member E; histone 1, H4j; histone cluster 1, H4j; histone cluster 1 H4 family member j
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctggccgcggcaaaggcgggaagggtcttggcaaaggcggcgctaagcgccaccgtaaagtactgcgcgacaatatccagggcatcaccaagccggccatccggcgccttgctcgccgcggcggcgtgaagcgcatctccggcctcatctacgaggagactcgcggggtgctgaaggtgttcctggagaacgtgatccgggacgccgtgacctatacagagcacgccaagcgcaagacggtcaccgccatggatgtggtctacgcgctcaagcgccagggccgcaccctctacggtttcggtggttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: