Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of C1D-nuclear DNA-binding protein Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C1D-nuclear DNA-binding protein Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005235 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C1D |
| Origin species: | Human |
| Product name: | C1D-nuclear DNA-binding protein Gene |
| Size: | 2ug |
| Accessions: | BC005235 |
| Gene id: | 10438 |
| Gene description: | nuclear DNA-binding protein |
| Synonyms: | C1D nuclear receptor corepressor; C1D nuclear receptor co-repressor; C1D DNA-binding protein; nuclear nucleic acid-binding protein C1D; LRP1; Rrp47; SUN-CoR; SUNCOR; hC1D; nuclear DNA-binding protein; small unique nuclear receptor co-repressor; small unique nuclear receptor corepressor |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcaggtgaagaaattaatgaagactatccagtagaaattcacgagtatttgtcagcgtttgagaattccattggtgctgtggatgagatgctgaagaccatgatgtctgtttctagaaatgagttgttgcagaagttggatccacttgaacaagcaaaagtggatttggtttctgcatacacattaaattcaatgttttgggtttatttggcaacccaaggagttaatcctaaggaacatccagtaaaacaggaattggaaagaatcagagtatatatgaacagagtcaaggaaataacagacaagaaaaaggctggcaagctggacagaggtgcagcttcaagatttgtaaaaaatgccctctgggaaccaaaatcgaaaaatgcatcaaaagttgccaataaaggaaaaagcaaaagttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zymogen granule protein 16 - ferritin, light polypeptide - ferritin, light polypeptide - COMM domain containing 8 |