FTL-ferritin, light polypeptide Gene View larger

FTL-ferritin, light polypeptide Gene

PTXBC008439

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FTL-ferritin, light polypeptide Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FTL-ferritin, light polypeptide Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008439
Product type: DNA & cDNA
Ncbi symbol: FTL
Origin species: Human
Product name: FTL-ferritin, light polypeptide Gene
Size: 2ug
Accessions: BC008439
Gene id: 2512
Gene description: ferritin, light polypeptide
Synonyms: LFTD; NBIA3; ferritin light chain; ferritin L subunit; ferritin L-chain; ferritin light polypeptide-like 3; ferritin, light polypeptide
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagctcccagattcgtcagaattattccaccgacgtggaggcagccgtcaacagcctggtcaatttgtacctgcaggcctcctacacctacctctctctgggcttctatttcgaccgcgatgatgtggctctggaaggcgtgagccacttcttccgcgaactggccgaggagaagcgcgagggctacgagcgtctcctgaagatgcaaaaccagcgtggcggccgcgctctcttccaggacatcaagaagccagctgaagatgagtggggtaaaaccccagacgccatgaaagctgccatggccctggagaaaaagctgaaccaggcccttttggatcttcatgccctgggttctgcccgcacggacccccatctctgtgacttcctggagactcacttcctagatgaggaagtgaagcttatcaagaagatgggtgaccacctgaccaacctccacaggctgggtggcccggaggctgggctgggcgagtatctcttcgaaaggctcactctcaagcacgactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ferritin, light polypeptide
- COMM domain containing 8
- RWD domain containing 4A
- transmembrane protein 11

Buy FTL-ferritin, light polypeptide Gene now

Add to cart