Cart 37 Product Products 7 490,60 € (empty)
-
-
-
-
-
1 x KIAA0101-K...113,40 € -
1 x IGLV2-14-i...113,40 € -
1 x HIST1H3F-h...113,40 € -
-
-
1 x GADD45A-gr...113,40 € -
1 x C1orf71-ch...113,40 € -
1 x CD55-CD55...121,50 € -
-
-
-
-
-
1 x DTYMK-deox...113,40 € -
1 x CSRP2-cyst...113,40 € -
1 x SLC22A13-s...121,50 € -
1 x AMT-aminom...121,50 € -
1 x SLC25A2-so...121,50 € -
-
-
-
-
-
-
-
-
-
-
1 x DLX3-dista...121,50 € -
1 x STMN1-stat...113,40 € -
1 x LOC440337-...113,40 € -
-
1 x NCRNA00152...113,40 €
No products
To be determined Shipping
7 490,60 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 37 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 7 490,60 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 7 490,60 €
Data sheet of ZG16-zymogen granule protein 16 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ZG16-zymogen granule protein 16 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029149 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ZG16 |
| Origin species: | Human |
| Product name: | ZG16-zymogen granule protein 16 Gene |
| Size: | 2ug |
| Accessions: | BC029149 |
| Gene id: | 123887 |
| Gene description: | zymogen granule protein 16 |
| Synonyms: | secretory lectin ZG16; JCLN; JCLN1; ZG16A; zymogen granule membrane protein 16; jacalin-like lectin domain containing; zymogen granule protein 16 homolog; zymogen granule protein 16 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgacagtcgctctcctagcccttctctgtgcctcagcctctggcaatgccattcaggccaggtcttcctcctatagtggagagtatggaagtggtggtggaaagcgattctctcattctggcaaccagttggacggccccatcaccgccctccgggtccgagtcaacacatactacatcgtaggtcttcaggtgcgctatggcaaggtgtggagcgactatgtgggtggtcgcaacggagacctggaggagatctttctgcaccctggggaatcagtgatccaggtttctgggaagtacaagtggtacctgaagaagctggtatttgtgacagacaagggccgctatctgtcttttgggaaagacagtggcacaagtttcaatgccgtccccttgcaccccaacaccgtgctccgcttcatcagtggccggtctggttctctcatcgatgccattggcctgcactgggatgtttaccccactagctgcagcagatgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ferritin, light polypeptide - ferritin, light polypeptide - COMM domain containing 8 - RWD domain containing 4A |