Login to display prices
Login to display prices
SPANXB2-SPANX family, member B2 Gene View larger

SPANXB2-SPANX family, member B2 Gene

PTXBC034472

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPANXB2-SPANX family, member B2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SPANXB2-SPANX family, member B2 Gene

Proteogenix catalog: PTXBC034472
Ncbi symbol: SPANXB2
Product name: SPANXB2-SPANX family, member B2 Gene
Size: 2ug
Accessions: BC034472
Gene id: 100133171
Gene description: SPANX family, member B2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccaacaatccagtgtccgcaggctgaagaggagcgtcccctgtgaatccaacgaggccaacgaggccaatgaggccaacaagacgatgccggagaccccaactggggactcagacccgcaacctgctcctaaaaaaatgaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaacgtgaaaagaacatctccagaggaactggtgaatgaccacgcccgagagaacagaatcaaccccgaccaaatggaggaggaggaattcatagaaataacgactgaaagacctaaaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: