SPANXB2-SPANX family, member B2 Gene View larger

SPANXB2-SPANX family, member B2 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SPANXB2-SPANX family, member B2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SPANXB2-SPANX family, member B2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC034472
Product type: DNA & cDNA
Ncbi symbol: SPANXB2
Origin species: Human
Product name: SPANXB2-SPANX family, member B2 Gene
Size: 2ug
Accessions: BC034472
Gene id: 100133171
Gene description: SPANX family, member B2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggccaacaatccagtgtccgcaggctgaagaggagcgtcccctgtgaatccaacgaggccaacgaggccaatgaggccaacaagacgatgccggagaccccaactggggactcagacccgcaacctgctcctaaaaaaatgaaaacatctgagtcctcgaccatactagtggttcgctacaggaggaacgtgaaaagaacatctccagaggaactggtgaatgaccacgcccgagagaacagaatcaaccccgaccaaatggaggaggaggaattcatagaaataacgactgaaagacctaaaaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histone cluster 3, H2a
- nuclear DNA-binding protein
- zymogen granule protein 16
- ferritin, light polypeptide

Buy SPANXB2-SPANX family, member B2 Gene now

Add to cart