HIST2H4B-histone cluster 2, H4b Gene View larger

HIST2H4B-histone cluster 2, H4b Gene

PTXBC019846

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIST2H4B-histone cluster 2, H4b Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIST2H4B-histone cluster 2, H4b Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019846
Product type: DNA & cDNA
Ncbi symbol: HIST2H4B
Origin species: Human
Product name: HIST2H4B-histone cluster 2, H4b Gene
Size: 2ug
Accessions: BC019846
Gene id: 554313
Gene description: histone cluster 2, H4b
Synonyms: H4/o; histone H4; histone 2, H4b; histone cluster 2, H4b; histone cluster 2 H4 family member b
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccggcagaggaaagggcggaaaaggcttaggcaaagggggcgctaagcgccaccgcaaggtcttgagagacaacattcagggcatcaccaagcctgccattcggcgtctagctcggcgtggcggcgttaagcggatctctggcctcatttacgaggagacccgcggtgtgctgaaggtgttcctggagaatgtgattcgggacgcagtcacctacaccgagcacgccaagcgcaagaccgtcacagccatggatgtggtgtacgcgctcaagcgccaggggcgcaccctgtacggcttcggaggctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - histone cluster 1, H4j
- SPANX family, member B2
- histone cluster 3, H2a
- nuclear DNA-binding protein

Buy HIST2H4B-histone cluster 2, H4b Gene now

Add to cart