Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HIST2H4B-histone cluster 2, H4b Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HIST2H4B-histone cluster 2, H4b Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC019846 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HIST2H4B |
| Origin species: | Human |
| Product name: | HIST2H4B-histone cluster 2, H4b Gene |
| Size: | 2ug |
| Accessions: | BC019846 |
| Gene id: | 554313 |
| Gene description: | histone cluster 2, H4b |
| Synonyms: | H4/o; histone H4; histone 2, H4b; histone cluster 2, H4b; histone cluster 2 H4 family member b |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtccggcagaggaaagggcggaaaaggcttaggcaaagggggcgctaagcgccaccgcaaggtcttgagagacaacattcagggcatcaccaagcctgccattcggcgtctagctcggcgtggcggcgttaagcggatctctggcctcatttacgaggagacccgcggtgtgctgaaggtgttcctggagaatgtgattcgggacgcagtcacctacaccgagcacgccaagcgcaagaccgtcacagccatggatgtggtgtacgcgctcaagcgccaggggcgcaccctgtacggcttcggaggctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - histone cluster 1, H4j - SPANX family, member B2 - histone cluster 3, H2a - nuclear DNA-binding protein |