No products
Prices are tax excluded
PTXBC022485
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022485 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GNG4 |
| Origin species: | Human |
| Product name: | GNG4-guanine nucleotide binding protein (G protein), gamma 4 Gene |
| Size: | 2ug |
| Accessions: | BC022485 |
| Gene id: | 2786 |
| Gene description: | guanine nucleotide binding protein (G protein), gamma 4 |
| Synonyms: | guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4; guanine nucleotide binding protein (G protein), gamma 4; guanine nucleotide binding protein 4; G protein subunit gamma 4 |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaagagggcatgtctaataacagcaccactagcatctcccaagccaggaaagctgtggagcagctaaagatggaagcctgtatggacagggtcaaggtctcccaggcagctgcggacctcctggcctactgtgaagctcacgtgcgggaagatcctctcatcattccagtgcctgcatcagaaaacccctttcgcgagaagaagttcttttgtaccattctctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) - SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) - cytochrome c oxidase subunit VIIa polypeptide 2 like - cytochrome c oxidase subunit VIIa polypeptide 2 like |