GNG4-guanine nucleotide binding protein (G protein), gamma 4 Gene View larger

GNG4-guanine nucleotide binding protein (G protein), gamma 4 Gene

PTXBC022485

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GNG4-guanine nucleotide binding protein (G protein), gamma 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GNG4-guanine nucleotide binding protein (G protein), gamma 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022485
Product type: DNA & cDNA
Ncbi symbol: GNG4
Origin species: Human
Product name: GNG4-guanine nucleotide binding protein (G protein), gamma 4 Gene
Size: 2ug
Accessions: BC022485
Gene id: 2786
Gene description: guanine nucleotide binding protein (G protein), gamma 4
Synonyms: guanine nucleotide-binding protein G(I)/G(S)/G(O) subunit gamma-4; guanine nucleotide binding protein (G protein), gamma 4; guanine nucleotide binding protein 4; G protein subunit gamma 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaagagggcatgtctaataacagcaccactagcatctcccaagccaggaaagctgtggagcagctaaagatggaagcctgtatggacagggtcaaggtctcccaggcagctgcggacctcctggcctactgtgaagctcacgtgcgggaagatcctctcatcattccagtgcctgcatcagaaaacccctttcgcgagaagaagttcttttgtaccattctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
- SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
- cytochrome c oxidase subunit VIIa polypeptide 2 like
- cytochrome c oxidase subunit VIIa polypeptide 2 like

Buy GNG4-guanine nucleotide binding protein (G protein), gamma 4 Gene now

Add to cart