SUMO2-SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) Gene View larger

SUMO2-SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SUMO2-SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SUMO2-SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016775
Product type: DNA & cDNA
Ncbi symbol: SUMO2
Origin species: Human
Product name: SUMO2-SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC016775
Gene id: 6613
Gene description: SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
Synonyms: HSMT3; SMT3B; SMT3H2; SUMO3; Smt3A; small ubiquitin-related modifier 2; SMT3 homolog 2; SMT3 suppressor of mif two 3 homolog 2; sentrin 2; ubiquitin-like protein SMT3A; ubiquitin-like protein SMT3B; small ubiquitin-like modifier 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgacgaaaagcccaaggaaggagtcaagactgagaacaacgatcatattaatttgaaggtggcggggcaggatggttctgtggtgcagtttaagattaagaggcatacaccacttagtaaactaatgaaagcctattgtgaacgacagggattgtcaatgaggcagatcagattccgatttgacgggcaaccaatcaatgaaacagacacacctgcacagttggaaatggaggatgaagatacaattgatgtgttccaacagcagacgggaggtgtctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
- cytochrome c oxidase subunit VIIa polypeptide 2 like
- cytochrome c oxidase subunit VIIa polypeptide 2 like
- eukaryotic translation initiation factor 1A, X-linked

Buy SUMO2-SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) Gene now

Add to cart