Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene
PTXBC005251
New product
Data sheet of COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC005251 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | COX7A2L |
| Origin species: | Human |
| Product name: | COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene |
| Size: | 2ug |
| Accessions: | BC005251 |
| Gene id: | 9167 |
| Gene description: | cytochrome c oxidase subunit VIIa polypeptide 2 like |
| Synonyms: | COX7AR; COX7RP; EB1; SIG81; cytochrome c oxidase subunit 7A-related protein, mitochondrial; COX7a-related protein; cytochrome c oxidase subunit VII-related protein; cytochrome c oxidase subunit VIIa polypeptide 2 like; cytochrome c oxidase subunit VIIa-related protein; estrogen receptor binding CpG island; cytochrome c oxidase subunit 7A2 like |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtactacaagtttagtggcttcacgcagaagttggcaggagcatgggcttcggaggcctatagcccgcagggattaaagcctgtggtttccacagaagcaccacctatcatatttgccacaccaactaaactgacctccgattccacagtgtatgattatgctgggaaaaacaaagttccagagctacaaaagtttttccagaaagctgatggtgtgcccgtctacctgaaacgaggcctgcctgaccaaatgctttaccggaccaccatggcgctgactgtgggagggaccatctactgcctgatcgccctctacatggcttcgcagcccaaaaacaaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - eukaryotic translation initiation factor 1A, X-linked - eukaryotic translation initiation factor 1A, Y-linked - glycine cleavage system protein H (aminomethyl carrier) - ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast) |