SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene View larger

SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006462
Product type: DNA & cDNA
Ncbi symbol: SUMO1
Origin species: Human
Product name: SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene
Size: 2ug
Accessions: BC006462
Gene id: 7341
Gene description: SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)
Synonyms: DAP1; GMP1; OFC10; PIC1; SENP2; SMT3; SMT3C; SMT3H3; UBL1; small ubiquitin-related modifier 1; GAP modifying protein 1; SMT3 homolog 3; SMT3 suppressor of mif two 3 homolog 1; sentrin; ubiquitin-homology domain protein PIC1; ubiquitin-like protein SMT3C; ubiquitin-like protein UBL1; small ubiquitin-like modifier 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgaccaggaggcaaaaccttcaactgaggacttgggggataagaaggaaggtgaatatattaaactcaaagtcattggacaggatagcagtgagattcacttcaaagtgaaaatgacaacacatctcaagaaactcaaagaatcatactgtcaaagacagggtgttccaatgaattcactcaggtttctctttgagggtcagagaattgctgataatcatactccaaaagaactgggaatggaggaagaagatgtgattgaagtttatcaggaacaaacggggggtcattcaacagtttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome c oxidase subunit VIIa polypeptide 2 like
- cytochrome c oxidase subunit VIIa polypeptide 2 like
- eukaryotic translation initiation factor 1A, X-linked
- eukaryotic translation initiation factor 1A, Y-linked

Buy SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene now

Add to cart