Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene
PTXBC006462
New product
Data sheet of SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006462 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SUMO1 |
| Origin species: | Human |
| Product name: | SUMO1-SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC006462 |
| Gene id: | 7341 |
| Gene description: | SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) |
| Synonyms: | DAP1; GMP1; OFC10; PIC1; SENP2; SMT3; SMT3C; SMT3H3; UBL1; small ubiquitin-related modifier 1; GAP modifying protein 1; SMT3 homolog 3; SMT3 suppressor of mif two 3 homolog 1; sentrin; ubiquitin-homology domain protein PIC1; ubiquitin-like protein SMT3C; ubiquitin-like protein UBL1; small ubiquitin-like modifier 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgaccaggaggcaaaaccttcaactgaggacttgggggataagaaggaaggtgaatatattaaactcaaagtcattggacaggatagcagtgagattcacttcaaagtgaaaatgacaacacatctcaagaaactcaaagaatcatactgtcaaagacagggtgttccaatgaattcactcaggtttctctttgagggtcagagaattgctgataatcatactccaaaagaactgggaatggaggaagaagatgtgattgaagtttatcaggaacaaacggggggtcattcaacagtttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytochrome c oxidase subunit VIIa polypeptide 2 like - cytochrome c oxidase subunit VIIa polypeptide 2 like - eukaryotic translation initiation factor 1A, X-linked - eukaryotic translation initiation factor 1A, Y-linked |