COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene View larger

COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene

PTXBC007095

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007095
Product type: DNA & cDNA
Ncbi symbol: COX7A2L
Origin species: Human
Product name: COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene
Size: 2ug
Accessions: BC007095
Gene id: 9167
Gene description: cytochrome c oxidase subunit VIIa polypeptide 2 like
Synonyms: COX7AR; COX7RP; EB1; SIG81; cytochrome c oxidase subunit 7A-related protein, mitochondrial; COX7a-related protein; cytochrome c oxidase subunit VII-related protein; cytochrome c oxidase subunit VIIa polypeptide 2 like; cytochrome c oxidase subunit VIIa-related protein; estrogen receptor binding CpG island; cytochrome c oxidase subunit 7A2 like
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtactacaagtttagtggtttcacgcagaagttggcaggagcatgggcttcggaggcctatagcccgcagggattaaagcctgtggtttccacagaagcaccacctatcatatttgccacaccaactaaactgacctccgattccacagtgtatgattatgctgggaaaaacaaagttccagagctacaaaagtttttccagaaagctgatggtgtgcccgtctacctgaaacgaggcctgcctgaccaaatgctttaccggaccaccatggcgctgactgtgggagggaccatctactgcctgatcgccctctacatggcttcgcagcccaaaaacaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome c oxidase subunit VIIa polypeptide 2 like
- eukaryotic translation initiation factor 1A, X-linked
- eukaryotic translation initiation factor 1A, Y-linked
- glycine cleavage system protein H (aminomethyl carrier)

Reviews

Buy COX7A2L-cytochrome c oxidase subunit VIIa polypeptide 2 like Gene now

Add to cart