FAM167B-family with sequence similarity 167, member B Gene View larger

FAM167B-family with sequence similarity 167, member B Gene

PTXBC004269

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM167B-family with sequence similarity 167, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM167B-family with sequence similarity 167, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004269
Product type: DNA & cDNA
Ncbi symbol: FAM167B
Origin species: Human
Product name: FAM167B-family with sequence similarity 167, member B Gene
Size: 2ug
Accessions: BC004269
Gene id: 84734
Gene description: family with sequence similarity 167, member B
Synonyms: protein FAM167B; C1orf90; family with sequence similarity 167 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcaggcgcaggacaggcagctggcagggcagctgctgcggctgcgggcccagctgcaccgactgaagatggaccaagcctgtcacctgcaccaggagctgctggatgaggccgagctggagctggagctggagcccggggccggcctagccctggccccgctgctgcggcacctgggcctcacgcgcatgaacatcagcgcccggcgcttcaccctctgctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - transcription elongation factor A (SII)-like 7
- interferon, alpha-inducible protein 27-like 1
- cytochrome c oxidase subunit VIa polypeptide 1
- CDKN2A interacting protein N-terminal like

Buy FAM167B-family with sequence similarity 167, member B Gene now

Add to cart