FAM175A-family with sequence similarity 175, member A Gene View larger

FAM175A-family with sequence similarity 175, member A Gene

PTXBC016905

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM175A-family with sequence similarity 175, member A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM175A-family with sequence similarity 175, member A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016905
Product type: DNA & cDNA
Ncbi symbol: FAM175A
Origin species: Human
Product name: FAM175A-family with sequence similarity 175, member A Gene
Size: 2ug
Accessions: BC016905
Gene id: 84142
Gene description: family with sequence similarity 175, member A
Synonyms: ABRA1; CCDC98; BRCA1-A complex subunit Abraxas; abraxas protein; coiled-coil domain containing 98; family with sequence similarity 175 member A
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagtctcattctgtcgcccagactggagtgaagtggcatgatctcggctcactgcaacctctgcctctcgaggtcaagcgattctcctgcctcggcctccggagtagctgggattacaggcacacgcaaccatgcccggctaattttttttgtatttttagtagagatggggtttcaccatgttggccaggctggtctcgaactcctgacctcaagtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - family with sequence similarity 167, member B
- transcription elongation factor A (SII)-like 7
- interferon, alpha-inducible protein 27-like 1
- cytochrome c oxidase subunit VIa polypeptide 1

Buy FAM175A-family with sequence similarity 175, member A Gene now

Add to cart