Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of HOPX-HOP homeobox Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HOPX-HOP homeobox Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC014225 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HOPX |
| Origin species: | Human |
| Product name: | HOPX-HOP homeobox Gene |
| Size: | 2ug |
| Accessions: | BC014225 |
| Gene id: | 84525 |
| Gene description: | HOP homeobox |
| Synonyms: | CAMEO; HOD; HOP; LAGY; NECC1; OB1; SMAP31; TOTO; homeodomain-only protein; lung cancer-associated Y protein; not expressed in choriocarcinoma clone 1; odd homeobox protein 1; HOP homeobox |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcggcggagaccgcgagcggccccacagaggaccaggtggaaatcctggagtacaacttcaacaaggtcgacaagcacccggattccaccacgctgtgcctcatcgcggccgaggcaggcctttccgaggaggagacccagaaatggtttaagcagcgcctggcaaagtggcggcgctcagaaggcctgccctcagagtgcagatccgtcatagactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - KIAA0101 - G antigen 5 - transthyretin - KIAA1143 |