PTXBC018649
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018649 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR2L |
| Origin species: | Human |
| Product name: | POLR2L-polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa Gene |
| Size: | 2ug |
| Accessions: | BC018649 |
| Gene id: | 5441 |
| Gene description: | polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa |
| Synonyms: | RBP10; RPABC5; RPB10; RPB10beta; RPB7.6; hRPB7.6; DNA-directed RNA polymerases I, II, and III subunit RPABC5; DNA-directed RNA polymerase III subunit L; RNA polymerase II 7.6 kDa subunit; RNA polymerases I, II, and III subunit ABC5; RPB10 homolog; polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa; polymerase (RNA) II subunit L; RNA polymerase II subunit L |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatcatccctgtacgctgcttcacttgtggcaagatcgtcggcaacaagtgggaggcttacctggggctgctgcaggccgagtacaccgagggggacgcgctggatgccctgggcctgaagcgctactgctgccgccggatgctgctggcccacgtggacctgatcgagaagctgctcaattatgcacccctggagaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa - phospholipase A2, group IIA (platelets, synovial fluid) - tumor necrosis factor, alpha-induced protein 8-like 1 - cysteine and glycine-rich protein 3 (cardiac LIM protein) |