PCDHGC3-protocadherin gamma subfamily C, 3 Gene View larger

PCDHGC3-protocadherin gamma subfamily C, 3 Gene

PTXBC004321

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PCDHGC3-protocadherin gamma subfamily C, 3 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PCDHGC3-protocadherin gamma subfamily C, 3 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004321
Product type: DNA & cDNA
Ncbi symbol: PCDHGC3
Origin species: Human
Product name: PCDHGC3-protocadherin gamma subfamily C, 3 Gene
Size: 2ug
Accessions: BC004321
Gene id: 5098
Gene description: protocadherin gamma subfamily C, 3
Synonyms: PC43; PCDH-GAMMA-C3; PCDH2; protocadherin gamma-C3; cadherin-like 2; protocadherin 43; protocadherin-2; protocadherin gamma subfamily C, 3
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggattgagcgcccgctacggaccccagttcaccctgcagcacgtgcccgactaccgccagaatgtctacatcccaggcagcaatgccacactgaccaacgcagctggcaagcgggatggcaaggccccagcaggtggcaatggcaacaagaagaagtcgggcaagaaggagaagaagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - mannosidase, beta A, lysosomal-like
- chromosome 4 open reading frame 42
- chromosome 2 open reading frame 56
- chromosome 4 open reading frame 34

Buy PCDHGC3-protocadherin gamma subfamily C, 3 Gene now

Add to cart