Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of C1orf170-chromosome 1 open reading frame 170 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about C1orf170-chromosome 1 open reading frame 170 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006300 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | C1orf170 |
| Origin species: | Human |
| Product name: | C1orf170-chromosome 1 open reading frame 170 Gene |
| Size: | 2ug |
| Accessions: | BC006300 |
| Gene id: | 84808 |
| Gene description: | chromosome 1 open reading frame 170 |
| Synonyms: | C1orf170; PGC-1 and ERR-induced regulator in muscle protein 1; PGC-1 and ERR-induced regulator in muscle 1; PPARGC1 and ESRR-induced regulator in muscle 1; peroxisome proliferator-activated receptor gamma coactivator 1 and estrogen-related receptor-induced regulator in muscle 1; PPARGC1 and ESRR induced regulator, muscle 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgcctggtgtttgtagcttttgccacctgggctgtgaggacgtcagatccgcataccccagacgcctggaaaacagccttgctggccaacgtcggcaccatctctgccatccgctacttccgccggcaggcggggcaagggcgccgcagccacagccccagccccagctcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - catenin, beta interacting protein 1 - chromosome 15 open reading frame 48 - chromosome 16 open reading frame 57 - chromosome 16 open reading frame 52 |