C12orf62-chromosome 12 open reading frame 62 Gene View larger

C12orf62-chromosome 12 open reading frame 62 Gene

PTXBC007849

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C12orf62-chromosome 12 open reading frame 62 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C12orf62-chromosome 12 open reading frame 62 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007849
Product type: DNA & cDNA
Ncbi symbol: C12orf62
Origin species: Human
Product name: C12orf62-chromosome 12 open reading frame 62 Gene
Size: 2ug
Accessions: BC007849
Gene id: 84987
Gene description: chromosome 12 open reading frame 62
Synonyms: C12orf62; cytochrome c oxidase assembly protein COX14; COX14 cytochrome c oxidase assembly homolog; cytochrome c oxidase assembly homolog 14; COX14, cytochrome c oxidase assembly factor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccaactggcaagcagctagctgacattggctataagaccttctctacctccatgatgcttctcactgtgtatggggggtacctctgcagtgtccgagtctaccactatttccagtggcgcagggcccagcgccaggccgcagaagaacagaagacctcaggaatcatgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 1 open reading frame 170
- catenin, beta interacting protein 1
- chromosome 15 open reading frame 48
- chromosome 16 open reading frame 57

Buy C12orf62-chromosome 12 open reading frame 62 Gene now

Add to cart