C6orf123-chromosome 6 open reading frame 123 Gene View larger

C6orf123-chromosome 6 open reading frame 123 Gene

PTXBC027853

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C6orf123-chromosome 6 open reading frame 123 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C6orf123-chromosome 6 open reading frame 123 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC027853
Product type: DNA & cDNA
Ncbi symbol: C6orf123
Origin species: Human
Product name: C6orf123-chromosome 6 open reading frame 123 Gene
Size: 2ug
Accessions: BC027853
Gene id: 26238
Gene description: chromosome 6 open reading frame 123
Synonyms: HGC6.2; RP3-431P23.4; dJ431P23.4; chromosome 6 open reading frame 123
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcacggctgtgggaccccatcattcccctgccccgcatgactctgctctcccagctcgactgctcacttcagacttcccttatggaaggagttgccagatagagcaagtaaaatacagtgtgccagacacaggtttatttcaacactgggaaggctccattcctacttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 12 open reading frame 62
- chromosome 1 open reading frame 170
- catenin, beta interacting protein 1
- chromosome 15 open reading frame 48

Buy C6orf123-chromosome 6 open reading frame 123 Gene now

Add to cart