Login to display prices
Login to display prices
SHC4-SHC (Src homology 2 domain containing) family, member 4 Gene View larger

SHC4-SHC (Src homology 2 domain containing) family, member 4 Gene

PTXBC033907

New product

Data sheet of SHC4-SHC (Src homology 2 domain containing) family, member 4 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SHC4-SHC (Src homology 2 domain containing) family, member 4 Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC033907
Ncbi symbol: SHC4
Product name: SHC4-SHC (Src homology 2 domain containing) family, member 4 Gene
Size: 2ug
Accessions: BC033907
Gene id: 399694
Gene description: SHC (Src homology 2 domain containing) family, member 4
Synonyms: RaLP; SHCD; SHC-transforming protein 4; SH2 domain protein C4; SHC (Src homology 2 domain containing) family, member 4; SHC-transforming protein D; hShcD; rai-like protein; src homology 2 domain-containing-transforming protein C4; SHC adaptor protein 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgagaacgcggccaggacagcctggcaggactcgtgctgtatgtaggactcttcgggcaccccgggatgctgcacagggccaagtacagccgctttcggaacgagtcgatcacgtccttggacgaaggtagctccggaggctcggtcggggacaagggctcgccgcagcctccccaccccgccctggcacctcacctgccgactgaagatgccaccttgccgtcgcaggagagccccaccccactgtgcaccttgatcccccgcatggcaagcatgaagctggccaacccggccactttgctgagtctgaaaaacttttgcctgggtaccaaagaggtgcctcggctgaagctccaggaaagccgggacccaggttccagcggcccctcttccccagaaaccagtttaagtaggtccgggactgcacctccaccgcagcaggacctggtgggacacagggcaaccgccctaacccctgattcgtgcccgcttcctggccctggggagccaacacttaggagcaggcaggacaggcactttctacagcacctgttggggatgggcatgaactactgtgtgaggtacatgggctgtgttgaagtgctgcaatcaatgagatcactggattttggaatgagaacccaagttacaagggaagcaataagtcgcctgtgtgaagctgtccccggggcaaatggagccattaaaaagcgaaagcctccagttgagttcctatcaacagtccttggcaaaagtaatcttcagttttcaggaatgaatataaaactgaccatctcaacatgcagtctcacattgatgaatcttgacaaccaacagattattgcaaatcatcatatgcagtctatttcatttgcctctggaggggatcctgatactacagactatgttgcctacgtagctaaagatccagttaatcaacgagcctgtcacatattggaatgccacaatggaatggcccaagacgtcataagtaccatagggcaggcttttgaactccggtttaaacagtacttgaaaaatccttctttgaatacttcttgtgaaagtgaggaggtgcatattgatagccatgccgaggagagagaagatcatgaatattacaatgaaattccagggaagcagccaccagtaggtggtgtttcagatatgcggatcaaagttcaagccacggaacaaatggcttactgccccatacagtgtgaaaagttgtgctatttgcctggaaactccaagtgcagcagtgtatatgagaactgtttagaacaaagcagggcaataggtaatgtccatccaagaggggtgcagtcccagcgaggtacctcattattgaagcacacgtgccgagtggatctctttgatgacccctgctacattaatacacaggctcttcaaagtacacctggctctgctggaaatcaaaggtcagcccaaccactggggagcccatggcactgcggaaaggcaccagaaactgttcagccgggtgccacagcccagcctgccagctcacattctttgccacacattaagcagcagctgtggagcgaagaatgctatcatggcaagctgagcaggaaggcggcagagagcctcttggtaaaggatggggactttttggttcgagagagtgcaacatcccctggccaatatgtgctgagtggactacagggaggccaagcaaaacatcttctcctggtggatcctgaaggcaaggtgaggaccaaggatcatgtatttgataatgtcggccaccttatcagataccatatggataacagtttgccaatcatctcctctggaagcgaagtaagccttaaacaaccagtgagaaaagataataatccagcacttttgcattccaacaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: