COCH-coagulation factor C homolog, cochlin (Limulus polyphemus) Gene View larger

COCH-coagulation factor C homolog, cochlin (Limulus polyphemus) Gene

PTXBC007230

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of COCH-coagulation factor C homolog, cochlin (Limulus polyphemus) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about COCH-coagulation factor C homolog, cochlin (Limulus polyphemus) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007230
Product type: DNA & cDNA
Ncbi symbol: COCH
Origin species: Human
Product name: COCH-coagulation factor C homolog, cochlin (Limulus polyphemus) Gene
Size: 2ug
Accessions: BC007230
Gene id: 1690
Gene description: coagulation factor C homolog, cochlin (Limulus polyphemus)
Synonyms: COCH-5B2; COCH5B2; DFNA9; cochlin; coagulation factor C homolog, cochlin (Limulus polyphemus)
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtccgcagcctggatcccggctctcggcctcggtgtgtgtctgctgctgctgccggggcccgcgggcagcgagggagccgctcccattgctatcacatgttttaccagaggcttggacatcaggaaagagaaagcagatgtcctctgcccagggggctgccctcttgaggaattctctgtgtatgggaacatagtatatgcttctgtatcgagcatatgtggggctgctgtccacaggggagtaatcagcaactcagggggacctgtacgagtctatagcctacctggtcgagaaaactattcctcagtagatgccaatggcatccagtctcaaatgctttctagatggtctgcttctttcacagtaactaaaggcaaaagtagtacacaggaggccacaggacaagcagtgtccacagcacatccaccaacaggtaaacgactaaagaaaacacccgagaagaaaactggcaataaagattgtaaagcagacattgcatttctgattgatggaagctttaatattgggcagcgccgatttaatttacagaagaattttgttggaaaagtggctctaatgttgggaattggaacagaaggaccacatgtgggccttgttcaagccagtgaacatcccaaaatagaattttacttgaaaaactttacatcagccaaagatgttttgtttgccataaaggaagtaggtttcagagggggtaattccaatacaggaaaagccttgaagcatactgctcagaaattcttcacggtagatgctggagtaagaaaagggatccccaaagtggtggtggtatttattgatggttggccttctgatgacatcgaggaagcaggcattgtggccagagagtttggtgtcaatgtatttatagtttctgtggccaagcctatccctgaagaactggggatggttcaggatgtcacatttgttgacaaggctgtctgtcggaataatggcttcttctcttaccacatgcccaactggtttggcaccacaaaatacgtaaagcctctggtacagaagctgtgcactcatgaacaaatgatgtgcagcaagacctgttataactcagtgaacattgcctttctaattgatggctccagcagtgttggagatagcaatttccgcctcatgcttgaatttgtttccaacatagccaagacttttgaaatctcggacattggtgccaagatagctgctgtacagtttacttatgatcagcgcacggagttcagtttcactgactatagcaccaaagagaatgtcctagctgtcatcagaaacatccgctatatgagtggtggaacagctactggtgatgccatttccttcactgttagaaatgtgtttggccctataagggagagccccaacaagaacttcctagtaattgtcacagatgggcagtcctatgatgatgtccaaggccctgcagctgctgcacatgatgcagcaaaataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polymerase (RNA) II (DNA directed) polypeptide L, 7.6kDa
- cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa
- phospholipase A2, group IIA (platelets, synovial fluid)
- tumor necrosis factor, alpha-induced protein 8-like 1

Buy COCH-coagulation factor C homolog, cochlin (Limulus polyphemus) Gene now

Add to cart