DDC-dopa decarboxylase (aromatic L-amino acid decarboxylase) Gene View larger

DDC-dopa decarboxylase (aromatic L-amino acid decarboxylase) Gene

PTXBC000485

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of DDC-dopa decarboxylase (aromatic L-amino acid decarboxylase) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about DDC-dopa decarboxylase (aromatic L-amino acid decarboxylase) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000485
Product type: DNA & cDNA
Ncbi symbol: DDC
Origin species: Human
Product name: DDC-dopa decarboxylase (aromatic L-amino acid decarboxylase) Gene
Size: 2ug
Accessions: BC000485
Gene id: 1644
Gene description: dopa decarboxylase (aromatic L-amino acid decarboxylase)
Synonyms: AADC; aromatic-L-amino-acid decarboxylase; dopa decarboxylase (aromatic L-amino acid decarboxylase); dopa decarboxylase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgcaagtgaattccgaaggagagggaaggagatggtggattacgtggccaactacatggaaggcattgagggacgccaggtctaccctgacgtggagcccgggtacctgcggccgctgatccctgccgctgcccctcaggagccagacacgtttgaggacatcatcaacgacgttgagaagataatcatgcctggggtgacgcactggcacagcccctacttcttcgcctacttccccactgccagctcgtacccggccatgcttgcggacatgctgtgcggggccattggctgcatcggcttctcctgggcggcaagcccagcatgcacagagctggagactgtgatgatggactggctcgggaagatgctggaactaccaaaggcatttttgaatgagaaagctggagaagggggaggagtgatccagggaagtgccagtgaagccaccctggtggccctgctggccgctcggaccaaagtgatccatcggctgcaggcagcgtccccagagctcacacaggccgctatcatggagaagctggtggcttactcatccgatcaggcacactcctcagtggaaagagctgggttaattggtggagtgaaattaaaagccatcccctcagatggcaacttcgccatgcgtgcgtctgccctgcaggaagccctggagagagacaaagcggctggcctgattcctttctttatggttgccaccctggggaccacaacatgctgctcctttgacaatctcttagaagtcggtcctatctgcaacaaggaagacatatggctgcacgttgatgcagcctacgcaggcagtgcattcatctgccctgagttccggcaccttctgaatggagtggagtttgcagattcattcaactttaatccccacaaatggctattggtgaattttgactgttctgccatgtgggtgaaaaagagaacagacttaacgggagcctttagactggaccccacttacctgaagcacagccatcaggattcagggcttatcactgactaccggcattggcagataccactgggcagaagatttcgctctttgaaaatgtggtttgtatttaggatgtatggagtcaaaggactgcaggcttatatccgcaagcatgtccagctgtcccatgagtttgagtcactggtgcgccaggatccccgctttgaaatctgtgtggaagtcattctggggcttgtctgctttcggctaaagggttccaacaaagtgaatgaagctcttctgcaaagaataaacagtgccaaaaaaatccacttggttccatgtcacctcagggacaagtttgtcctgcgctttgccatctgttctcgcacggtggaatctgcccatgtgcagcgggcctgggaacacatcaaagagctggcggccgacgtgctgcgagcagagagggagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SHC (Src homology 2 domain containing) family, member 4
- guanine nucleotide binding protein (G protein), gamma 4
- SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)
- SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)

Buy DDC-dopa decarboxylase (aromatic L-amino acid decarboxylase) Gene now

Add to cart