PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene View larger

PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene

PTXBC000512

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000512
Product type: DNA & cDNA
Ncbi symbol: PSMC1
Origin species: Human
Product name: PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene
Size: 2ug
Accessions: BC000512
Gene id: 5700
Gene description: proteasome (prosome, macropain) 26S subunit, ATPase, 1
Synonyms: P26S4; p56; 26S protease regulatory subunit 4; 26S proteasome AAA-ATPase subunit RPT2; proteasome (prosome, macropain) 26S subunit, ATPase, 1; proteasome 26S ATPase subunit 1; proteasome 26S subunit, ATPase 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggtcaaagtcagagtggtggtcatggtcctggaggtggcaagaaggatgacaaggacaagaaaaagaaatatgaacctcctgtaccaactagagtggggaaaaagaagaagaaaacaaagggaccagatgctgccagcaaactgccactggtgacacctcacactcagtgccggttaaaattactgaagttagagagaattaaagactatcttctcatggaggaagaattcattagaaatcaggaacaaatgaaaccattagaagaaaagcaagaggaggaaagatcaaaagtggatgatctgagggggaccccgatgtcagtaggaaccttggaagagattattgatgacaatcatgccatcgtgtctacatctgtgggctcagaacactacgtcagcattctttcatttgtagacaaggatctgctggaacctggctgctcggtcctgctcaaccacaaggtgcatgccgtgataggggtgctgatggatgacacggatcccctggtcacagtgatgaaggtagaaaaggccccccaggagacctatgcagatattggggggttggacaaccaaattcaggaaattaaggaatctgtggagcttcctctcacccatcctgaatattatgaagagatgggtataaagcctcctaagggggtcattctctatggtccacctggcacaggtaaaaccttgttagccaaagcagtagcaaaccaaacctcagccactttcttgagagtggttggctctgaacttattcagaagtacctaggtgatgggcccaaactcgtacgggaattgttccgagttgctgaagaacatgcaccgtccatcgtgtttattgatgaaattgacgccattgggacaaaaagatatgactccaattctggtggtgagagagaaattcagcgaacaatgttggaactgctgaaccagttggatggatttgattctaggggagatgtgaaagttatcatggccacaaaccgaatagaaactttggatccagcacttatcagaccaggccgcattgacaggaagattgagttccccctgcctgatgaaaagacgaagaagcgcatctttcagattcacacaagcaggatgacgctggctgatgatgtaaccctggacgacctgatcatggctaaagatgacctctctggtgctgacatcaaggcaatctgtacagaagctggtctgatggccttaagagaacgtagaatgaaagtaacaaatgaagacttcaaaaaatctaaagaaaatgttctttataagaaacaggaaggcacccctgaggggctgtatctctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - dopa decarboxylase (aromatic L-amino acid decarboxylase)
- SHC (Src homology 2 domain containing) family, member 4
- guanine nucleotide binding protein (G protein), gamma 4
- SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae)

Buy PSMC1-proteasome (prosome, macropain) 26S subunit, ATPase, 1 Gene now

Add to cart