CYP2W1-cytochrome P450, family 2, subfamily W, polypeptide 1 Gene View larger

CYP2W1-cytochrome P450, family 2, subfamily W, polypeptide 1 Gene

PTXBC025761

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CYP2W1-cytochrome P450, family 2, subfamily W, polypeptide 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CYP2W1-cytochrome P450, family 2, subfamily W, polypeptide 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025761
Product type: DNA & cDNA
Ncbi symbol: CYP2W1
Origin species: Human
Product name: CYP2W1-cytochrome P450, family 2, subfamily W, polypeptide 1 Gene
Size: 2ug
Accessions: BC025761
Gene id: 54905
Gene description: cytochrome P450, family 2, subfamily W, polypeptide 1
Synonyms: cytochrome P450 2W1; CYPIIW1; cytochrome P450, family 2, subfamily W, polypeptide 1; cytochrome P450 family 2 subfamily W member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagctctcagaacgctacgggccggtgttcaccgtgcacctggggcgccagaagacggtggtgctgacggggttcgaggcggtcaaagaggcgctggcgggccccgggcaggagctggccgaccggcctcccatcgccatcttccagctcatccagcgaggtggaggcatcttcttctcatctggggcgcgctggagggctgcccgccagttcacggtgcgtgccctgcacagcctgggcgtgggccgggagccggtggctgacaagattctgcaggagctgaaatgcctctctgggcagctggatggctacagaggccggcccttcccgctggccctactgggctgggctccctccaatatcaccttcgcgctcctcttcggccgccgatttgactaccgggaccccgtgtttgtgtccctgctgggtctcatcgatgaggtcatggtcctcttggggtcccctggcctgcagctgttcaacgtctacccatggctcggggccctgctccagctgcaccggcccgtcctgcgcaagatcgaggaggtccgtgccattctgaggaccctcctggaggcgcggaggccccacgtgtgcccgggggaccccgtgtgcagctatgtggacgccctgatccagcagggacagggggatgaccccgagggcctgtttgctgaggccaacgcggtggcctgcaccctggacatggtcatggccgggacggagacgacctcggccacgctgcagtgggccgcacttctgatgggccggcacccggacgtgcagggccgggtgcaggaggagctagaccgcgtgctgggccctgggcggactccccggctggaggaccagcaggctctgccctacacaagcgccgtgctccacgaggtgcagcggttcatcacgctcctgccgcacgtgccccgctgcaccgcggccgacacacagctgggcggcttcctgctccccaagggcacgcccgtgattcccctgctgacctcggtgctcctggatgagacacagtggcagaccccaggccagttcaaccccggccatttcctggacgcgaatgggcactttgtgaagcgggaggccttcctgcctttctctgcaggccgccgcgtctgtgttggggagcgcctggccaggaccgagctcttcctgctgtttgccggcctcctgcagaggtaccgcctgctgcccccgcctggcgtcagtccggcctccctggacaccacgcccgcccgggcttttaccatgaggccgagggcccaggccctgtgtgcggtgcccaggccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - proteasome (prosome, macropain) 26S subunit, ATPase, 1
- dopa decarboxylase (aromatic L-amino acid decarboxylase)
- SHC (Src homology 2 domain containing) family, member 4
- guanine nucleotide binding protein (G protein), gamma 4

Buy CYP2W1-cytochrome P450, family 2, subfamily W, polypeptide 1 Gene now

Add to cart